92
|
OriGene
hp227909 human psa rp gacgtgataccttgaagcacacc origene Hp227909 Human Psa Rp Gacgtgataccttgaagcacacc Origene, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/Prostate+Specific+Antigen+(KLK3)+Human+qPCR+Primer+Pair/pmc11224269__41467_2024_49978_MOESM1_ESM-130-205-209 Average 92 stars, based on 1 article reviews
hp227909 human psa rp gacgtgataccttgaagcacacc origene - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
puma hs00248075 gene specific primer probe sets Puma Hs00248075 Gene Specific Primer Probe Sets, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/puma+hs00248075+gene+specific+primer+probe+sets/10__1158_slash_1535___7163__mct___17___0600-55-12-17 Average 86 stars, based on 1 article reviews
puma hs00248075 gene specific primer probe sets - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
95
|
Chem Impex International
carboxyphenol ba Carboxyphenol Ba, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/Salicylic+acid/pm33543929-33-0-5 Average 95 stars, based on 1 article reviews
carboxyphenol ba - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
18s rna specific primer hs99999901 18s Rna Specific Primer Hs99999901, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/18S+RNA+specific+primer+Hs99999901/pm25155522-99-8-13 Average 86 stars, based on 1 article reviews
18s rna specific primer hs99999901 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
puma bbc3 hs00248075 gene specific primer probe sets Puma Bbc3 Hs00248075 Gene Specific Primer Probe Sets, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/puma+bbc3+hs00248075+gene+specific+primer+probe+sets/pmc04775372-82-15-21 Average 86 stars, based on 1 article reviews
puma bbc3 hs00248075 gene specific primer probe sets - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
93
|
fluidigm
multiplex fluidigm array Multiplex Fluidigm Array, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/Access+Array+Multiplex+Target-Specific+Primers/pm29404863-108-3-4 Average 93 stars, based on 1 article reviews
multiplex fluidigm array - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
90
|
Nihon Gene Research Laboratories
oligonucleotide primers and probes specific for s1p 1 Oligonucleotide Primers And Probes Specific For S1p 1, supplied by Nihon Gene Research Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/oligonucleotide+primers+and+probes+specific+for+s1p+1/pmc02118459-193-4-40 Average 90 stars, based on 1 article reviews
oligonucleotide primers and probes specific for s1p 1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Urogene S.A
methylation-specific pcr primers for gal-1 Methylation Specific Pcr Primers For Gal 1, supplied by Urogene S.A, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/methylation+specific+pcr+primers+for+gal+1/pmc03023883-114-1-12 Average 90 stars, based on 1 article reviews
methylation-specific pcr primers for gal-1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
3CR Bioscience
allele-specific primer 1 Allele Specific Primer 1, supplied by 3CR Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/allele+specific+primer+1/pm39901712-100-9-5 Average 90 stars, based on 1 article reviews
allele-specific primer 1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
cdna-specific primers microsynth Cdna Specific Primers Microsynth, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/cdna+specific+primers+microsynth/pmc02694977-59-2-3 Average 90 stars, based on 1 article reviews
cdna-specific primers microsynth - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc) 0.1–1.0 μm Of Antisense Gene Specific Oligonucleotide Primer (Mwgbiotech, High Point, Nc), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/0+1+1+0+%CE%BCm+of+antisense+gene+specific+oligonucleotide+primer++mwgbiotech++high+point++nc+/pmc02576272-315-20-24 Average 90 stars, based on 1 article reviews
0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc) - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GenoVision VertriebsgesmbH
hla-specific primer oligos Hla Specific Primer Oligos, supplied by GenoVision VertriebsgesmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/specific+primers/hla+specific+primer+oligos/us07993638-327-9-13 Average 90 stars, based on 1 article reviews
hla-specific primer oligos - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |